The super-n-motifs model
Comparing RNA secondary structures of arbitrary size uncovers structural patterns that can provide a better understanding of RNA functions. However, performing fast and accurate secondary structure comparisons is challenging when we take into account the RNA configuration (i.e., linear or circular), the presence of pseudoknot and G-quadruplex (G4) motifs and the increasing number of secondary structures generated by high-throughput probing techniques. To address this challenge, we propose the super-n-motifs model, based on a latent analysis of enhanced motifs comprising not only basic motifs but also adjacency relations. The super-n-motifs model computes a vector representation of secondary structures as linear combinations of these motifs.
-
Download here the ubuntu 64bit executable and follow the ‘how to use it’ instructions to compare secondary structures.
-
Or follow the instructions below to compile and use the Super-n-motifs program on almost every computer platform.
How to compile the Super-n-motifs program ?
-
Download the source code here and unzip.
-
Open the terminal,
cd path_to_supernmotifs_programto access the super-n-motifs program folder then compile it by running the commandmake. -
The executable file named ‘supernmotifs’ can be found in
path_to_supernmotifs_program.
How to use it?
- Compare secondary structures by calling:
/path_to_supernmotifs_program/supernmotifs -i fileInDb -o folderOfResults - The Super-n-motifs program takes as input a file of rna secondary structures in dot-bracket format (-i fileInDb):
>RNA1 GCCCCGCUGAUGAGGUCAGGGAAAACCGAAAGUGUCGACUCUACGGGGC ((((((.......((((......))))...((((....)))).))))))It ouputs a dissimilarity matrix and various stats by default (-o folderOfResults) . For further options:
./path_to_supernmotifs_program/supernmotifs -h - The super-n-motifs model supports circular RNA, pseudoknots and g-quadruplexes. Circular RNAs require to add
c_to the header of each RNA :>c_RNA1. Base pairs involved in pseudoknots are typically represented by special characters{},<>,[], and alphabets such asAaorBb:..AA..aa. Interacting guanines in g-quadruplexes are represented by+:..((..++.++.++..++.))..
How to cite the Super-n-motifs model ?
Glouzon JS, Perreault JP, Wang S. The super-n-motifs model: a novel alignment-free approach for representing and comparing RNA secondary structures. Bioinformatics. 2017 Jan 14. pii: btw773. doi: 10.1093/bioinformatics/btw773
Licence
The Super-n-motifs model is released under the terms of the GNU GPL licence. For further informations, please see the LICENCE file of the repository.